pMpGE006
(Plasmid
#108722)
-
PurposeCas9 expression in M.polymorpha
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 108722 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepMpGWB103
-
Backbone manufacturerKohchi Lab., Kyoto
- Backbone size w/o insert (bp) 11315
- Total vector size (bp) 15938
-
Vector typePlant Expression, CRISPR
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAtco-Cas9-Pea3ter
-
SpeciesSynthetic
-
Insert Size (bp)4623
- Promoter MpEFpro
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer CACCATGGATAAGAAGTACTCTATCGG
- 3′ sequencing primer CAGGAAACAGCTATGACCATG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byAtco-Cas9-Pea3ter is from Holger Puchta Lab. Fauser et al. (2014) Plant J
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/early/2018/03/14/277350 for BioRxiv preprint
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMpGE006 was a gift from Takayuki Kohchi & Shigeo Sugano (Addgene plasmid # 108722 ; http://n2t.net/addgene:108722 ; RRID:Addgene_108722) -
For your References section:
Efficient CRISPR/Cas9-based genome editing and its application to conditional genetic analysis in Marchantia polymorpha. Sugano SS, Nishihama R, Shirakawa M, Takagi J, Matsuda Y, Ishida S, Shimada T, Hara-Nishimura I, Osakabe K, Kohchi T. PLoS One. 2018 Oct 31;13(10):e0205117. doi: 10.1371/journal.pone.0205117. eCollection 2018. 10.1371/journal.pone.0205117 PubMed 30379827