pET-6xHis-SUMO-MarathonRT
(Plasmid #109029)

• Purpose: Group II intron maturase from Eubacterium rectale (wild-type sequence). This is a highly processive reverse transcriptase that is called “MarathonRT”
• Depositing Lab: Anna Pyle
• Publication: Zhao et al RNA. 2018 Feb;24(2):183-195. doi: 10.1261/rna.063479.117. Epub 2017 Nov 6.

Backbone

• Vector backbone: ChampionTM pET SUMO
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 5643
• Total vector size (bp): 6927
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: ERE_01490
• Species: Eubacterium rectale (Eu.re.I2)
• Insert Size (bp): 1284
• GenBank ID: CBK92290.1
• Promoter: T7
• Tag / Fusion Protein:
  • 6xHis-SUMO tag (N terminal on backbone)

Cloning Information

• Cloning method: TOPO Cloning
• 5′ sequencing primer: TTTGGACATGGAGGATAACG
• 3′ sequencing primer: TAAGTTGGCAGCATCACCCG

Resource Information

• Supplemental Documents:
  • MarathonRT Suggested Protocol and Information.pdf
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry