Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

1518_pAAV-U6-SA-eGFP-gRNA-HLP-SACas9-HA-OLLAS-spA
(Plasmid #109316)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 109316 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pEMBL8
  • Backbone size w/o insert (bp) 6967
  • Total vector size (bp) 6966
  • Modifications to backbone
    SaCas9 was cloned from Addgene Plasmid #61593
  • Vector type
    Mammalian Expression, AAV, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    eGFP gRNA
  • gRNA/shRNA sequence
    GGGGTCTTTGCTCAGGGCGGA

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer CCTTCATATTTGCATATACGATACAAGGCTGTTAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    1518_pAAV-U6-SA-eGFP-gRNA-HLP-SACas9-HA-OLLAS-spA was a gift from William Lagor (Addgene plasmid # 109316 ; http://n2t.net/addgene:109316 ; RRID:Addgene_109316)
  • For your References section:

    A Self-Deleting AAV-CRISPR System for In Vivo Genome Editing. Li A, Lee CM, Hurley AE, Jarrett KE, De Giorgi M, Lu W, Balderrama KS, Doerfler AM, Deshmukh H, Ray A, Bao G, Lagor WR. Mol Ther Methods Clin Dev. 2018 Dec 6;12:111-122. doi: 10.1016/j.omtm.2018.11.009. eCollection 2019 Mar 15. 10.1016/j.omtm.2018.11.009 PubMed 30619914