pBN396
(Plasmid
#109326)
-
PurposeExpresses FLP enzyme and fluorescent mNeonGreen in the C. elegans germ line
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 109326 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepBN338
-
Backbone manufacturerAskjaer lab
- Total vector size (bp) 10791
-
Vector typeWorm Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemex-5
-
Alt namemex-5 promoter
-
SpeciesC. elegans (nematode)
-
Insert Size (bp)486
-
Entrez Genemex-5 (a.k.a. CELE_W02A2.7)
- Promoter mex-5
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (unknown if destroyed)
- 3′ cloning site KpnI (unknown if destroyed)
- 5′ sequencing primer gctctgcgagaaatagtacagca (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBN396 was a gift from Peter Askjaer (Addgene plasmid # 109326 ; http://n2t.net/addgene:109326 ; RRID:Addgene_109326)