This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

A3Bi-ctd E255A -Cas9n-UGI-NLS
(Plasmid #109429)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 109429 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    BE3
  • Backbone manufacturer
    David Liu
  • Backbone size w/o insert (bp) 7822
  • Total vector size (bp) 9294
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Apolipoprotein mRNA Editing Enzyme, Catalytic Polypeptide-like 3B C-terminal Doman E255A Catalytic Mutant
  • Alt name
    APOBEC3B C-terminal Domain E255A
  • Alt name
    A3Bctd E5255A
  • Alt name
    A3B ctd CM
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1472
  • Mutation
    Insertion of an L1 intron into the coding sequence of A3B to prevent mutation in E. coli, only cloned catalytically dead mutant C-terminal domain, site-directed E255A to make the protein catalytically inactive
  • Entrez Gene
    APOBEC3B (a.k.a. A3B, APOBEC1L, ARCD3, ARP4, DJ742C19.2, PHRBNL, bK150C2.2)
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site XmaI (not destroyed)
  • 5′ sequencing primer CGTGTACGGTGGGAGGTCTA
  • 3′ sequencing primer CAAAGAAGGAACCAGGTCCA
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    A3Bi-ctd E255A -Cas9n-UGI-NLS was a gift from Reuben Harris (Addgene plasmid # 109429 ; http://n2t.net/addgene:109429 ; RRID:Addgene_109429)
  • For your References section:

    A fluorescent reporter for quantification and enrichment of DNA editing by APOBEC-Cas9 or cleavage by Cas9 in living cells. St Martin A, Salamango D, Serebrenik A, Shaban N, Brown WL, Donati F, Munagala U, Conticello SG, Harris RS. Nucleic Acids Res. 2018 May 9. pii: 4994269. doi: 10.1093/nar/gky332. 10.1093/nar/gky332 PubMed 29746667