Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pCC324
(Plasmid #110165)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 110165 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCFJ910
  • Backbone manufacturer
    Addgene Plasmid #44481
  • Backbone size w/o insert (bp) 5496
  • Total vector size (bp) 15703
  • Vector type
    Worm Expression ; miniMos transposon
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ERK-KTR-mClover-T2A-mCherry-H2B
  • Alt name
    ERK-nKTR
  • Alt name
    ERK-KTR-mClover
  • Alt name
    mCherry-H2B
  • Species
    H. sapiens (human), C. elegans (nematode), Synthetic
  • Insert Size (bp)
    2253
  • Mutation
    R61K change made in ERK-KTR CDS
  • Promoter lin-31 promoter/enhancer
  • Tags / Fusion Proteins
    • mClover (C terminal on insert)
    • mCherry (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer caggaaacagctatgaccatg
  • 3′ sequencing primer tgtaaaacgacggccagt
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    ERK-KTR-mClover coding sequence was derived from pENTR-ERKKTRClover, Addgene Plasmid #59138.
  • Article Citing this Plasmid

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCC324 was a gift from Iva Greenwald (Addgene plasmid # 110165 ; http://n2t.net/addgene:110165 ; RRID:Addgene_110165)
  • For your References section:

    A Real-Time Biosensor for ERK Activity Reveals Signaling Dynamics during C. elegans Cell Fate Specification. de la Cova C, Townley R, Regot S, Greenwald I. Dev Cell. 2017 Sep 11;42(5):542-553.e4. doi: 10.1016/j.devcel.2017.07.014. Epub 2017 Aug 17. 10.1016/j.devcel.2017.07.014 PubMed 28826819