-
PurposeDoxycycline-inducible overexpression of Sox2
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 110280 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCWtre-hpaI-pacI-rtTAiBlast
- Backbone size w/o insert (bp) 9501
- Total vector size (bp) 10461
-
Modifications to backboneNone
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSRY (sex determining region Y)-box 2
-
Alt nameSox2
-
Alt namelcc
-
Alt nameysb
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)960
-
MutationWild type
-
GenBank IDNM_011443.4
-
Entrez GeneSox2 (a.k.a. Sox-2, lcc, ysb)
- Promoter TRE
-
Tag
/ Fusion Protein
- No fusion genes
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HpaI (not destroyed)
- 3′ cloning site PacI (not destroyed)
- 5′ sequencing primer AGAACGTATGTCGAGGTAGGCG
- 3′ sequencing primer GGCCAGATCTTGGGTGGGTTAATTAAG (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Lenti-TetON-Sox2 was a gift from Trudy Oliver (Addgene plasmid # 110280 ; http://n2t.net/addgene:110280 ; RRID:Addgene_110280) -
For your References section:
The Lineage-Defining Transcription Factors SOX2 and NKX2-1 Determine Lung Cancer Cell Fate and Shape the Tumor Immune Microenvironment. Mollaoglu G, Jones A, Wait SJ, Mukhopadhyay A, Jeong S, Arya R, Camolotto SA, Mosbruger TL, Stubben CJ, Conley CJ, Bhutkar A, Vahrenkamp JM, Berrett KC, Cessna MH, Lane TE, Witt BL, Salama ME, Gertz J, Jones KB, Snyder EL, Oliver TG. Immunity. 2018 Oct 16;49(4):764-779.e9. doi: 10.1016/j.immuni.2018.09.020. 10.1016/j.immuni.2018.09.020 PubMed 30332632