pQC MCS IRES Puro
(Plasmid #110343)

• Purpose: (Empty Backbone) γ-Retroviral transfer vector for cloning and expressing your gene of interest. IRES-driven Puromycin selection.
• Depositing Lab: Sandra Martha Gomes Dias
• Publication: Adamoski et al Nat Struct Mol Biol. 2023 Dec;30(12):1902-1912. doi: 10.1038/s41594-023-01118-0. Epub 2023 Oct 19.

Backbone

• Vector backbone: pQC mKorange IX
• Backbone manufacturer: #37344
• Backbone size (bp): 7013
• Modifications to backbone: Puromycin resistance from pLKO.1 - TRC cloning vector (Addgene #10878) were removed with BamHI and KpnI and blunted to fit EcoRV site from pQC mKorange IX (Addgene #37344). AgeI and EcoRI sites were also used to replace mKorange with synthetic MCS derived from annealed oligos (5' CCGGGGATCCGGTTCTAGAGCCACCGGTTGTATGGAGTTTAAACTCCAAAGCATCGATGGTAGCGGCCGCGGTGAATTCTGATT 3' and 5' AATTAATCAGAATTCACCGCGGCCGCTACCATCGATGCTTTGGAGTTTAAACTCCATACAACCGGTGGCTCTAGAACCGGATCC 3')
• Vector type: Mammalian Expression, Retroviral
• Promoter: CMV
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ sequencing primer: pQC Seq Fow 5'-ACGCCATCCACGCTGTTTTGACCT-3'
• 3′ sequencing primer: pQC Seq Rev 5'-AAGCGGCTTCGGCCAGTAACGTTA-3'

Resource Information

• Supplemental Documents:
  • pD013-pQC MCS IRES Puro.gb
• A portion of this plasmid was derived from a plasmid made by: Used sequences from pQC mKorange IX (Addgene #37344), Dr. Connie Cepko and pLKO.1 - TRC cloning vector (Addgene #10878), Dr. David Root

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

pQC-based γ-Retroviral transfer vector for cloning and expressing your gene of interest. IRES-driven Puromycin selection.

Also available as:
V5-mKO2-MCS-IRES-Puro (Addgene #110341)
V5 MCS IRES Puro (Addgene #110342)
MCS IRES Puro (Addgene #110343)
MCS IRES G418 (Addgene #110344)
V5 MCS IRES G418 (Addgene #110345)

All vectors can be used for TA-cloning (After XcmI cleavage), or BamHI-AgeI-PmeI-EcoRI restriction cloning.

Weinberg Lab recommends using pUMVC (Addgene #8449) and VSV-G (#8454) for packaging.