This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #11048)


Full plasmid sequence is not available for this item.


Item Catalog # Description Quantity Price (USD)
Plasmid 11048 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 5400
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
  • Alt name
  • Alt name
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • Entrez Gene
    CDC73 (a.k.a. C1orf28, FIHP, HPTJT, HRPT1, HRPT2, HYX)
  • Tag / Fusion Protein
    • Flag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer T7
  • 3′ sequencing primer SP6
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses

Depositor Comments

Author has deposited insert sequence. Click on "sequence" to view. Cloned using the following primers 5' CGGAATTCGGATCCACCATGGATTACAAGGATGACGACGATAAGGTCGACATGGCGGACGTGCTTAGCGT 3' and 5' CCGCTCGAGTCAGAATCTCAAGTGCGATTTATGCTT 3'

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3 HRPT2 was a gift from Matthew Meyerson (Addgene plasmid # 11048 ; ; RRID:Addgene_11048)
  • For your References section:

    The parafibromin tumor suppressor protein is part of a human Paf1 complex. Rozenblatt-Rosen O, Hughes CM, Nannepaga SJ, Shanmugam KS, Copeland TD, Guszczynski T, Resau JH, Meyerson M. Mol Cell Biol. 2005 Jan . 25(2):612-20. 10.1128/MCB.25.2.612-620.2005 PubMed 15632063