-
PurposeBacterial expression of Lbpro
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 110759 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
Currently unavailable outside the U.S.
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepET11d
-
Backbone manufacturerMerck
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameLb pro
-
SpeciesFoot and mouth disease virus (FMDV)
- Promoter T7
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GGGTTATGCTAGTTATTGC (Common Sequencing Primers)
Resource Information
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Lbpro (29-195) was a gift from Tim Skern (Addgene plasmid # 110759 ; http://n2t.net/addgene:110759 ; RRID:Addgene_110759) -
For your References section:
Structure of the foot-and-mouth disease virus leader protease: a papain-like fold adapted for self-processing and eIF4G recognition. Guarne A, Tormo J, Kirchweger R, Pfistermueller D, Fita I, Skern T. EMBO J. 1998 Dec 15;17(24):7469-79. doi: 10.1093/emboj/17.24.7469. 10.1093/emboj/17.24.7469 PubMed 9857201