Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

Lbpro (29-195)
(Plasmid #110759)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 110759 Standard format: Plasmid sent in bacteria as agar stab 1 $75

Currently unavailable outside the U.S.

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Lb pro
  • Species
    Foot and mouth disease virus (FMDV)
  • Promoter T7

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GGGTTATGCTAGTTATTGC
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Lbpro (29-195) was a gift from Tim Skern (Addgene plasmid # 110759 ; http://n2t.net/addgene:110759 ; RRID:Addgene_110759)
  • For your References section:

    Structure of the foot-and-mouth disease virus leader protease: a papain-like fold adapted for self-processing and eIF4G recognition. Guarne A, Tormo J, Kirchweger R, Pfistermueller D, Fita I, Skern T. EMBO J. 1998 Dec 15;17(24):7469-79. doi: 10.1093/emboj/17.24.7469. 10.1093/emboj/17.24.7469 PubMed 9857201