Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pRP(Exp)-CMV> ORF_924bp (Azgp1):T2A:dTomato:IRES:Puro
(Plasmid #110830)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 110830 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pUC19
  • Backbone manufacturer
    vector builder
  • Backbone size w/o insert (bp) 5722
  • Total vector size (bp) 6646
  • Vector type
    non-viral gene expression vector
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    AZGP1
  • Alt name
    ZAG-T2A-dT
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    924
  • Entrez Gene
    Azgp1 (a.k.a. Zag)
  • Promoter CMV
  • Tags / Fusion Proteins
    • dTomato (C terminal on backbone)
    • T2A (C terminal on insert)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer ORF_924bp (Azgp1)-reverse primer: CTGAGGCTGAGCTACAACATTG
  • 3′ sequencing primer CMV-forward primer: TTGACGCAAATGGGCGGTAGG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    vector builder

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRP(Exp)-CMV> ORF_924bp (Azgp1):T2A:dTomato:IRES:Puro was a gift from Ande Satyanarayana (Addgene plasmid # 110830 ; http://n2t.net/addgene:110830 ; RRID:Addgene_110830)
  • For your References section:

    The tumor secretory factor ZAG promotes white adipose tissue browning and energy wasting. Elattar S, Dimri M, Satyanarayana A. FASEB J. 2018 Mar 23:fj201701465RR. doi: 10.1096/fj.201701465RR. 10.1096/fj.201701465RR PubMed 29570397