Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #111066)


Full plasmid sequence is not available for this item.


Item Catalog # Description Quantity Price (USD)
Plasmid 111066 Standard format: Plasmid sent in bacteria as agar stab 1 $75
AAV1 111066-AAV1 Virus (100 µL at titer ≥ 7×10¹² vg/mL) and Plasmid.

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 4579
  • Total vector size (bp) 6622
  • Vector type

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy


  • Gene/Insert name
  • Species
  • Insert Size (bp)
  • GenBank ID
  • Tag / Fusion Protein
    • Flag tag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BaMHI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer ccggccaccttggtcgcgtcc
  • 3′ sequencing primer ggagaaaatgaaagccatacgggaagc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Information for AAV1 (Catalog # 111066-AAV1) ( Back to top )


Ready-to-use AAV1 particles produced from pAAV-hSyn-dLight1.1 (#111066). In addition to the viral particles, you will also receive purified pAAV-hSyn-dLight1.1 plasmid DNA.

hSyn-driven expression of dLight1.1 dopamine sensor. These AAV preparations are suitable purity for injection into animals.


  • Volume 100 µL
  • Titer ≥ 7×10¹² vg/mL
  • Pricing $350 USD for preparation of 100 µL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV1 cap gene
  • Buffer PBS + 0.001% Pluronic F-68
  • Serotype AAV1
  • Purification Iodixanol gradient ultracentrifugation


Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Terms and Licenses

Viral Quality Control

Quality Control:
  • Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
  • Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Visit our viral production page for more information.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-hSyn-dLight1.1 was a gift from Lin Tian (Addgene plasmid # 111066 ; ; RRID:Addgene_111066)

    For viral preps, please replace (Addgene plasmid # 111066) in the above sentence with: (Addgene viral prep # 111066-AAV1)

  • For your References section:

    Ultrafast neuronal imaging of dopamine dynamics with designed genetically encoded sensors. Patriarchi T, Cho JR, Merten K, Howe MW, Marley A, Xiong WH, Folk RW, Broussard GJ, Liang R, Jang MJ, Zhong H, Dombeck D, von Zastrow M, Nimmerjahn A, Gradinaru V, Williams JT, Tian L. Science. 2018 Jun 29;360(6396). pii: science.aat4422. doi: 10.1126/science.aat4422. Epub 2018 May 31. 10.1126/science.aat4422 PubMed 29853555