pFUGW-RapACR-EYFP
(Plasmid
#111075)
-
PurposeFast anion channelrhodopsin (current half-decay time 3-10 ms depending on voltage and light intensity) for time-resolved inhibition of neuronal spiking
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 111075 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepFUGW
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameAnion channelrhodopsin RapACR
-
SpeciesRhodomonas salina
-
Insert Size (bp)921
-
GenBank IDMG831192
-
Tag
/ Fusion Protein
- EYFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer TGAACTATGCGCTCGGGGTTGGCG (Common Sequencing Primers)
Resource Information
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFUGW-RapACR-EYFP was a gift from John Spudich (Addgene plasmid # 111075 ; http://n2t.net/addgene:111075 ; RRID:Addgene_111075)