-
PurposeTom20 with selflabeling tag, e.g. for fluorescence microscopy
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 111135 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepSEMS(26m)
-
Backbone manufacturerCovalys, NEB
- Backbone size w/o insert (bp) 5325
- Total vector size (bp) 6570
-
Modifications to backboneoriginal snap-Tag substituted by Halo7-Tag
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameReceptor of tranlocase of outer mitochondrial membrane Tom20
-
Alt nameTom20
-
SpeciesH. sapiens (human)
-
Insert Size (bp)435
-
Entrez GeneTOMM20 (a.k.a. MAS20, MOM19, TOM20)
- Promoter CMV
-
Tag
/ Fusion Protein
- Halo7 Tag (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRV (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer ATGGTGGGTCGGAACAGCGCCAT
- 3′ sequencing primer TTCCACATCATCTTCAGCCAAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSEMS-Tom20-Halo7Tag was a gift from Karin Busch (Addgene plasmid # 111135 ; http://n2t.net/addgene:111135 ; RRID:Addgene_111135) -
For your References section:
Nanoscale organization of mitochondrial microcompartments revealed by combining tracking and localization microscopy. Appelhans T, Richter CP, Wilkens V, Hess ST, Piehler J, Busch KB. Nano Lett. 2012 Feb 8;12(2):610-6. doi: 10.1021/nl203343a. Epub 2012 Jan 13. 10.1021/nl203343a PubMed 22201267