pAAV-hSyn-DIO {mCAR}off-{GCaMP6f}on-WPRE
(Plasmid
#111393)
-
PurposeAAV vector with hSynapsin promoter, Cre-OFF mCAR (for efficient CAV-2 infection) and Cre-ON GCaMP6f (ultrasensitive calcium sensor)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 111393 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAV
- Backbone size w/o insert (bp) 4836
- Total vector size (bp) 6615
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsStbl3
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namemCAR
-
Alt namemouse CAR variant 2
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1056
-
GenBank IDNM_009988
-
Entrez GeneCxadr (a.k.a. 2610206D03Rik, CAR, MCAR, MCVADR)
- Promoter hSynapsin
-
Tag
/ Fusion Protein
- Myc (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site AscI (not destroyed)
- 3′ cloning site PacI (not destroyed)
- 5′ sequencing primer CCAAATTGCGCATCCCCTATC (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameGCaMP6f
-
Alt nameGCaMP6 fast
-
SpeciesSynthetic
-
Insert Size (bp)1350
- Promoter hSynapsin
-
Tags
/ Fusion Proteins
- 6xHis (N terminal on insert)
- T7 (N terminal on insert)
- Xpress (N terminal on insert)
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site PacI (not destroyed)
- 3′ cloning site SpeI (destroyed during cloning)
- 5′ sequencing primer CATGGCTGGCAGAAATGACG
- 3′ sequencing primer GCAGCGTATCCACATAGCG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byBackbone comes from plasmid pAAV-Ef1a-DIO-{ChETA-EYFP} (Addgene, Plasmid #26968)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-hSyn-DIO {mCAR}off-{GCaMP6f}on-WPRE was a gift from Adam Kepecs (Addgene plasmid # 111393 ; http://n2t.net/addgene:111393 ; RRID:Addgene_111393) -
For your References section:
A Viral Receptor Complementation Strategy to Overcome CAV-2 Tropism for Efficient Retrograde Targeting of Neurons. Li SJ, Vaughan A, Sturgill JF, Kepecs A. Neuron. 2018 Jun 6;98(5):905-917.e5. doi: 10.1016/j.neuron.2018.05.028. 10.1016/j.neuron.2018.05.028 PubMed 29879392