RAB11A-mCherry HDRT Source (pTR 144)
(Plasmid
#112013)
-
PurposeDNA sequence source for amplifying an HDR template to tag endogenous human RAB11A gene with mCherry
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 112013 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepUC19
- Backbone size w/o insert (bp) 2686
-
Vector typeCRISPR, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRAB11A-mCherry HDRT
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1368
-
Entrez GeneRAB11A (a.k.a. YL8)
Cloning Information
- Cloning method Gibson Cloning
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
gRNA sequence that can be used with this DNA template: GGTAGTCGTACTCGTCGTCG
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
RAB11A-mCherry HDRT Source (pTR 144) was a gift from Alexander Marson (Addgene plasmid # 112013 ; http://n2t.net/addgene:112013 ; RRID:Addgene_112013) -
For your References section:
Reprogramming human T cell function and specificity with non-viral genome targeting. Roth TL, Puig-Saus C, Yu R, Shifrut E, Carnevale J, Li PJ, Hiatt J, Saco J, Krystofinski P, Li H, Tobin V, Nguyen DN, Lee MR, Putnam AL, Ferris AL, Chen JW, Schickel JN, Pellerin L, Carmody D, Alkorta-Aranburu G, Del Gaudio D, Matsumoto H, Morell M, Mao Y, Cho M, Quadros RM, Gurumurthy CB, Smith B, Haugwitz M, Hughes SH, Weissman JS, Schumann K, Esensten JH, May AP, Ashworth A, Kupfer GM, Greeley SAW, Bacchetta R, Meffre E, Roncarolo MG, Romberg N, Herold KC, Ribas A, Leonetti MD, Marson A. Nature. 2018 Jul 11. pii: 10.1038/s41586-018-0326-5. doi: 10.1038/s41586-018-0326-5. 10.1038/s41586-018-0326-5 PubMed 29995861