pHis-parallel1-NLSH2BCas9
(Plasmid
#112065)
-
PurposeExpression and purification of NLSH2BCas9 for fungal gene editing
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 112065 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepHis-parallel1
-
Backbone manufacturerSheffield et al (1999) Protein Expression Purification 15, 34-39
- Backbone size w/o insert (bp) 5466
- Total vector size (bp) 9765
-
Modifications to backboneNone
-
Vector typeBacterial Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameNLS of the Fusarium oxysporum histone H2B fused to SpCas9 that was codon optimized fro Aspergillus niger
-
SpeciesFusarium oxysporum, Streptococcus pyogenes
-
Insert Size (bp)4299
-
MutationCas9 was codon optimized for Aspergillus niger
- Promoter promoter in vector
-
Tag
/ Fusion Protein
- His tag (N terminal on backbone)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer GGATCCGATGGCTCCCAAGGCTGCTG
- 3′ sequencing primer CCGCAAGCTTTCAGACCTTGCGCTTCTTC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe A. niger codon optimized Cas9 gene was obtained from Uffe Mortensen and was described in Nodvig et al. (2015) A CRISPR-Cas9 system for genetic engineering of filamentous fungi. PLoS ONE 10(7): e0133085.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHis-parallel1-NLSH2BCas9 was a gift from Jeff Coleman (Addgene plasmid # 112065 ; http://n2t.net/addgene:112065 ; RRID:Addgene_112065) -
For your References section:
Efficient genome editing in Fusarium oxysporum based on CRISPR/Cas9 ribonucleoprotein complexes. Wang Q, Cobine PA, Coleman JJ. Fungal Genet Biol. 2018 May 12. pii: S1087-1845(18)30081-1. doi: 10.1016/j.fgb.2018.05.003. 10.1016/j.fgb.2018.05.003 PubMed 29763675