Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
Holiday Schedule: Addgene will be closed December 24 - January 1, 2020. For more information, see our holiday shipping schedule. If you have any questions, please contact us at [email protected].

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #112673)


Item Catalog # Description Quantity Price (USD)
Plasmid 112673 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
    Adapted from lentiCRISPRv1
  • Backbone size w/o insert (bp) 6296
  • Modifications to backbone
    SV40 NLS separates 1st UGI and (codon optimized) 2nd UGI
  • Vector type
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy


  • Gene/Insert name
  • Alt name
  • Species
  • Insert Size (bp)
  • Mutation
    NLS sequence at the N-terminus and D10A
  • Promoter EF1s
  • Tag / Fusion Protein
    • FLAG (N terminal on backbone)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TAAGTGCAGTAGTCGCCGTG
  • 3′ sequencing primer TTAAGAATACCAGTCAATCTTTC
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti-BE4GamRA-P2A-Puro was a gift from Lukas Dow (Addgene plasmid # 112673 ; ; RRID:Addgene_112673)
  • For your References section:

    Optimized base editors enable efficient editing in cells, organoids and mice. Zafra MP, Schatoff EM, Katti A, Foronda M, Breinig M, Schweitzer AY, Simon A, Han T, Goswami S, Montgomery E, Thibado J, Kastenhuber ER, Sanchez-Rivera FJ, Shi J, Vakoc CR, Lowe SW, Tschaharganeh DF, Dow LE. Nat Biotechnol. 2018 Jul 3. pii: nbt.4194. doi: 10.1038/nbt.4194. 10.1038/nbt.4194 PubMed 29969439