This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #112857)


Item Catalog # Description Quantity Price (USD)
Plasmid 112857 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 4733
  • Total vector size (bp) 5410
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
    apolipoprotein B mRNA editing enzyme, catalytic polypeptide 1
  • Alt name
  • Species
    R. norvegicus (rat)
  • Insert Size (bp)
  • GenBank ID
  • Entrez Gene
    Apobec1 (a.k.a. REPR, apobec-1)
  • Promoter CMV promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer CGTGTACGGTGGGAGGTCTA
  • 3′ sequencing primer TTCAGGTTCAGGGGGAGGTG
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    rat APOBEC1-EGFP was a gift from Silvestro Conticello (Addgene plasmid # 112857 ; ; RRID:Addgene_112857)
  • For your References section:

    Flow-cytometric visualization of C>U mRNA editing reveals the dynamics of the process in live cells. Severi F, Conticello SG. RNA Biol. 2015;12(4):389-97. doi: 10.1080/15476286.2015.1026033. 10.1080/15476286.2015.1026033 PubMed 25806564