pCD185
(Plasmid #113317)

• Purpose: dCas9, MCP-SoxS_R93A
• Depositing Lab: Jesse Zalatan
• Publication: Dong et al Nat Commun. 2018 Jun 27;9(1):2489. doi: 10.1038/s41467-018-04901-6.

Backbone

• Vector backbone: p15A vector
• Vector type: Bacterial Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol, 25 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: dCas9 and MCP-SoxS_R93A
• Mutation: R93A

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CACGCATTGATTTGAGTCAGC
• 3′ sequencing primer: tcgtaagccatttccgctcg

Resource Information

• Supplemental Documents:
  • pCD185_dCas9_MCP-(5link)SoxS(R93A).gb
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry