pEJS593-pCSDest2-AcrIIC5Smu-BFPv2-IRES
(Plasmid
#113439)
-
PurposeExpresses type II-C anti-CRISPR protein from S. muelleri and a BFP from IRES in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 113439 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCSDest2
- Total vector size (bp) 7336
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameType II-C anti-CRISPR
-
SpeciesSimonsiella muelleri
-
Insert Size (bp)393
- Promoter CMV
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer ATTTAGGTGACACTATAGA (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namemTagBFP2
-
SpeciesSynthetic
-
Insert Size (bp)711
- Promoter CMV
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer cgcaaatgggcggtaggcgtg
- 3′ sequencing primer CAGGAAACAGCTATGAC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEJS593-pCSDest2-AcrIIC5Smu-BFPv2-IRES was a gift from Erik Sontheimer (Addgene plasmid # 113439 ; http://n2t.net/addgene:113439 ; RRID:Addgene_113439) -
For your References section:
Potent Cas9 Inhibition in Bacterial and Human Cells by AcrIIC4 and AcrIIC5 Anti-CRISPR Proteins. Lee J, Mir A, Edraki A, Garcia B, Amrani N, Lou HE, Gainetdinov I, Pawluk A, Ibraheim R, Gao XD, Liu P, Davidson AR, Maxwell KL, Sontheimer EJ. MBio. 2018 Dec 4;9(6). pii: mBio.02321-18. doi: 10.1128/mBio.02321-18. 10.1128/mBio.02321-18 PubMed 30514786