Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

7a sgRNA for EJ7-GFP and 4-μHOM reporters
(Plasmid #113620)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 113620 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    px330
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    7a sgRNA
  • gRNA/shRNA sequence
    gaccaccctgacctacggcta
  • Species
    Synthetic

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Bbs1 (destroyed during cloning)
  • 3′ cloning site Bbs1 (destroyed during cloning)
  • 5′ sequencing primer GACTATCATATGCTTACCGT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    7a sgRNA for EJ7-GFP and 4-μHOM reporters was a gift from Jeremy Stark (Addgene plasmid # 113620 ; http://n2t.net/addgene:113620 ; RRID:Addgene_113620)
  • For your References section:

    C-NHEJ without indels is robust and requires synergistic function of distinct XLF domains. Bhargava R, Sandhu M, Muk S, Lee G, Vaidehi N, Stark JM. Nat Commun. 2018 Jun 27;9(1):2484. doi: 10.1038/s41467-018-04867-5. 10.1038/s41467-018-04867-5 [pii] PubMed 29950655