KI(GAPDH)-P2A-EGFP-CMV-NeoR
(Plasmid #114009)

• Purpose: HDR-cassette to target chicken GAPDH gene for EGFP expression under control of the endogenous promoter. The cassette contains NeoR gene for positive clone selection and DTA gene for negative selection
• Depositing Lab: Pavel Volchkov
• Publication: Antonova et al F1000Res. 2018 Feb 28;7:238. doi: 10.12688/f1000research.13457.2. eCollection 2018.

Backbone

• Vector backbone: LSL-Cas9-Rosa26TV
• Backbone size w/o insert (bp): 4900
• Total vector size (bp): 7350
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: GAPDH left arm
• Species: G. gallus (chicken)
• Insert Size (bp): 1000
• GenBank ID: NM_204305.1
• Entrez Gene: GAPDH (a.k.a. KNC-NDS6)

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: MauBI (not destroyed)
• 3′ cloning site: PmeI (not destroyed)
• 5′ sequencing primer: TTGTTGACCTGACCTGCCGTCTGGAG
• 3′ sequencing primer: CTCCTTGGATGCCATGTGGACCATCAAG

Gene/Insert 2

• Gene/Insert name: eGFP
• Insert Size (bp): 700
• Promoter: endogenous promoter (chicken GAPDH in the case of insertion)

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: PmeI (not destroyed)
• 3′ cloning site: MluI (not destroyed)
• 5′ sequencing primer: ACATGGCATCCAAGGAGggtttaaac
• 3′ sequencing primer: cttgatatcgaattcctgcagggc

Gene/Insert 3

• Gene/Insert name: NeoR
• Insert Size (bp): 800
• Promoter: CMV

Cloning Information for Gene/Insert 3

• Cloning method: Restriction Enzyme
• 5′ cloning site: NotI (not destroyed)
• 3′ cloning site: AscI (not destroyed)
• 5′ sequencing primer: ctagtggtgccagggcgtgc
• 3′ sequencing primer: ggcgcgcccTAAGATACATTG

Gene/Insert 4

• Gene/Insert name: GAPDH right arm
• Species: G. gallus (chicken)
• Insert Size (bp): 3000
• GenBank ID: NM_204305.1
• Promoter: -

Cloning Information for Gene/Insert 4

• Cloning method: Restriction Enzyme
• 5′ cloning site: AscI (not destroyed)
• 3′ cloning site: SgrDI (not destroyed)
• 5′ sequencing primer: GCATTCTAGTTGTGGTTTGTCC
• 3′ sequencing primer: acccggtagaattcgatatcaagc

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry