KI(GAPDH)-P2A-EGFP-CMV-NeoR
(Plasmid
#114009)
-
PurposeHDR-cassette to target chicken GAPDH gene for EGFP expression under control of the endogenous promoter. The cassette contains NeoR gene for positive clone selection and DTA gene for negative selection
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 114009 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneLSL-Cas9-Rosa26TV
- Backbone size w/o insert (bp) 4900
- Total vector size (bp) 7350
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameGAPDH left arm
-
SpeciesG. gallus (chicken)
-
Insert Size (bp)1000
-
GenBank IDNM_204305.1
-
Entrez GeneGAPDH (a.k.a. KNC-NDS6)
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site MauBI (not destroyed)
- 3′ cloning site PmeI (not destroyed)
- 5′ sequencing primer TTGTTGACCTGACCTGCCGTCTGGAG
- 3′ sequencing primer CTCCTTGGATGCCATGTGGACCATCAAG (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameeGFP
-
Insert Size (bp)700
- Promoter endogenous promoter (chicken GAPDH in the case of insertion)
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site PmeI (not destroyed)
- 3′ cloning site MluI (not destroyed)
- 5′ sequencing primer ACATGGCATCCAAGGAGggtttaaac
- 3′ sequencing primer cttgatatcgaattcctgcagggc (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameNeoR
-
Insert Size (bp)800
- Promoter CMV
Cloning Information for Gene/Insert 3
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site AscI (not destroyed)
- 5′ sequencing primer ctagtggtgccagggcgtgc
- 3′ sequencing primer ggcgcgcccTAAGATACATTG (Common Sequencing Primers)
Gene/Insert 4
-
Gene/Insert nameGAPDH right arm
-
SpeciesG. gallus (chicken)
-
Insert Size (bp)3000
-
GenBank IDNM_204305.1
- Promoter -
Cloning Information for Gene/Insert 4
- Cloning method Restriction Enzyme
- 5′ cloning site AscI (not destroyed)
- 3′ cloning site SgrDI (not destroyed)
- 5′ sequencing primer GCATTCTAGTTGTGGTTTGTCC
- 3′ sequencing primer acccggtagaattcgatatcaagc (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
KI(GAPDH)-P2A-EGFP-CMV-NeoR was a gift from Pavel Volchkov (Addgene plasmid # 114009 ; http://n2t.net/addgene:114009 ; RRID:Addgene_114009) -
For your References section:
Successful CRISPR/Cas9 mediated homologous recombination in a chicken cell line. Antonova E, Glazova O, Gaponova A, Eremyan A, Zvereva S, Grebenkina N, Volkova N, Volchkov P. F1000Res. 2018 Feb 28;7:238. doi: 10.12688/f1000research.13457.2. eCollection 2018. 10.12688/f1000research.13457.2 PubMed 29946437