This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #114118)


Item Catalog # Description Quantity Price (USD)
Plasmid 114118 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
    V51 pIRESpuro-GLUE (pGLUE)
  • Backbone size w/o insert (bp) 5468
  • Total vector size (bp) 8177
  • Vector type
    Mammalian Expression
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
  • Alt name
  • Alt name
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • Entrez Gene
    SHLD2 (a.k.a. FAM35A, FAM35A1, RINN2, bA163M19.1)
  • Promoter CMV
  • Tags / Fusion Proteins
    • Streptavidin-binding tag (Streptag) (N terminal on backbone)
    • HA tag (N terminal on backbone)
    • calmodulin-binding peptide (CBP) (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AscI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer CMV Forward
  • 3′ sequencing primer pGLUE-seqR (ggacgcggccaccctcaaagg)
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

The SHLD2 short isoform cDNA was obtained from the ORFeome collection. The complete coding sequence of the long isoform of SHLD2 was generated by combining a synthesized fragment corresponding to the long isoform C-terminus using an internal KpnI site.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGLUE-SHLD2 was a gift from Daniel Durocher (Addgene plasmid # 114118 ; ; RRID:Addgene_114118)
  • For your References section:

    The shieldin complex mediates 53BP1-dependent DNA repair. Noordermeer SM, Adam S, Setiaputra D, Barazas M, Pettitt SJ, Ling AK, Olivieri M, Alvarez-Quilon A, Moatti N, Zimmermann M, Annunziato S, Krastev DB, Song F, Brandsma I, Frankum J, Brough R, Sherker A, Landry S, Szilard RK, Munro MM, McEwan A, Goullet de Rugy T, Lin ZY, Hart T, Moffat J, Gingras AC, Martin A, van Attikum H, Jonkers J, Lord CJ, Rottenberg S, Durocher D. Nature. 2018 Aug;560(7716):117-121. doi: 10.1038/s41586-018-0340-7. Epub 2018 Jul 18. 10.1038/s41586-018-0340-7 PubMed 30022168