Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pT2K-CAGGS-U6-sgRNA-M5-U6-sgRNA-M7-U6-sgRNA-M9-IRES-CFP
(Plasmid #114729)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 114729 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pT2K-CAGGS-IRES-CFP
  • Vector type
    Mammalian Expression, CRISPR
  • Selectable markers
    CFP

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgRNA M5, sgRNA M7, sgRNA M9
  • gRNA/shRNA sequence
    GGCAGGGCTTCGCCGACGCT & aaatagagagaggtggggaa & ACACCCCGGAGCCGGAGTAC
  • Species
    M. musculus (mouse)

Cloning Information

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pT2K-CAGGS-U6-sgRNA-M5-U6-sgRNA-M7-U6-sgRNA-M9-IRES-CFP was a gift from Martine Roussel (Addgene plasmid # 114729 ; http://n2t.net/addgene:114729 ; RRID:Addgene_114729)
  • For your References section:

    Mouse medulloblastoma driven by CRISPR activation of cellular Myc. Vo BT, Kwon JA, Li C, Finkelstein D, Xu B, Orr BA, Sherr CJ, Roussel MF. Sci Rep. 2018 Jun 7;8(1):8733. doi: 10.1038/s41598-018-24956-1. 10.1038/s41598-018-24956-1 [pii] PubMed 29880921