pgex6p-1mciap1mut
(Plasmid
#11484)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 11484 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepGEX6p-1
-
Backbone manufactureramersham
- Backbone size w/o insert (bp) 4900
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemciap1mut
-
Alt namemciap1
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1700
-
Mutation582 to alanine
-
Entrez GeneBirc2 (a.k.a. A, AW146227, Api1, Api2, Birc3, C-IAP1, C330006D17Rik, HI, HIAP1, HIAP2, I, IAP1, IAP2, MI, MIAP1, MIAP2, MIH, MIHB, MIHC, RNF48, cI, cIA, cIAP1, cIAP2, mcI, mcIAP1)
-
Tag
/ Fusion Protein
- GST (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer GGGCTGGCAAGCCACGTTTGGTGG
- 3′ sequencing primer TCCGGGAGCTGCATGTGTCAGAGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pgex6p-1mciap1mut was a gift from Jon Ashwell (Addgene plasmid # 11484 ; http://n2t.net/addgene:11484 ; RRID:Addgene_11484) -
For your References section:
Posttranscriptional downregulation of c-IAP2 by the ubiquitin protein ligase c-IAP1 in vivo. Conze DB, Albert L, Ferrick DA, Goeddel DV, Yeh WC, Mak T, Ashwell JD. Mol Cell Biol. 2005 Apr . 25(8):3348-56. 10.1128/MCB.25.8.3348-3356.2005 PubMed 15798218