1
Plasmid 1153: 104b-U1(WT)
  • HSP104

  • 5800

  • 3545

  • S. cerevisiae (budding yeast)

  • M67479

  • HSP104 (YLL026W)

  • GAL1:10 promoter

  • N terminal on insert

  • pRS316
    (Search Vector Database)

  • Yeast Expression

  • 4895

  • ClaI

  • No

  • SacI

  • No

  • GAAGCCGCCGAGCGGGTGAC List of Sequencing Primers

  • Ampicillin

  • DH5alpha

  • 37

  • High Copy

  • View sequences (1)
  • Susan Lindquist

  • MTA

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: Dominant gain-of-function mutations in Hsp104p reveal crucial roles for the middle region. Schirmer et al (Mol Biol Cell 2004 May;15(5):2061-72. Epub 2004 Feb 20. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 1153" in your Materials and Methods section.