Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pOsU3-esgRNA
(Plasmid #115629)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 115629 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pUC57
  • Vector type
    CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    OsU3p-esgRNA
  • gRNA/shRNA sequence
    gtttaagagctatgctggaaacagcatagcaagtttaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgc

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)
  • 3′ cloning site Unknown (unknown if destroyed)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pOsU3-esgRNA was a gift from Caixia Gao (Addgene plasmid # 115629 ; http://n2t.net/addgene:115629 ; RRID:Addgene_115629)
  • For your References section:

    Expanded base editing in rice and wheat using a Cas9-adenosine deaminase fusion. Li C, Zong Y, Wang Y, Jin S, Zhang D, Song Q, Zhang R, Gao C. Genome Biol. 2018 May 29;19(1):59. doi: 10.1186/s13059-018-1443-z. 10.1186/s13059-018-1443-z PubMed 29807545