Pinducer20-BSD-scFv-sfGFP-DNMT3A1
(Plasmid
#115780)
-
Purposetargeted DNA methylation tool
-
Depositing Lab
-
Sequence Information
-
Sequences (2) — Accept Affinity Reagent Sequence Policy
-
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 115780 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonePinducer 20
-
Backbone manufacturerStephen Elledge
- Backbone size w/o insert (bp) 11791
- Total vector size (bp) 14447
-
Vector typeMammalian Expression
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namescFv-sfGFP-DNMT3A1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)4500
-
Entrez GeneDNMT3A (a.k.a. DNMT3A2, HESJAS, M.HsaIIIA, TBRS)
- Promoter TRE
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer GGGGACAAGTTTGTACAAAAAAGCAGGCTCCATGGGCCCCGACATCGTGATGAC
- 3′ sequencing primer GGGGACCACTTTGTACAAGAAAGCTGGGTCttacacacacgcaaaatactccttcagc (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Pinducer20-BSD-scFv-sfGFP-DNMT3A1 was a gift from Margaret Goodell (Addgene plasmid # 115780 ; http://n2t.net/addgene:115780 ; RRID:Addgene_115780) -
For your References section:
Homeobox oncogene activation by pan-cancer DNA hypermethylation. Su J, Huang YH, Cui X, Wang X, Zhang X, Lei Y, Xu J, Lin X, Chen K, Lv J, Goodell MA, Li W. Genome Biol. 2018 Aug 10;19(1):108. doi: 10.1186/s13059-018-1492-3. 10.1186/s13059-018-1492-3 [pii] PubMed 30097071