Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at Learn more

(Plasmid #1160)

Add to Cart
Available to Academic and Nonprofits Only

  • Vector backbone
    TMBS (CEN TRP1 MET3 promoter)
  • Backbone size w/o insert (bp) 5000
  • Vector type
    Yeast Expression

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy

Sequence Information

Full plasmid sequence is available only if provided by the depositing laboratory.

  • Gene/Insert name
  • Alt name
  • Species
    S. cerevisiae (budding yeast)
  • Insert Size (bp)
  • Mutation
  • GenBank ID
  • Entrez Gene
    HSP104 (a.k.a. YLL026W)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site SacI (not destroyed)
  • 5′ sequencing primer CGGGATGAACGACCAAACGC
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
How to cite this plasmid

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    TM104b(G217S/T499I) was a gift from Susan Lindquist (Addgene plasmid # 1160)
  • For your References section:

    Dominant gain-of-function mutations in Hsp104p reveal crucial roles for the middle region. Schirmer EC, Homann OR, Kowal AS, Lindquist S. Mol Biol Cell 2004 May;15(5):2061-72. Epub 2004 Feb 20. 10.1091/mbc.E02-08-0502 PubMed 14978213