pSM-GFPnovo2
(Plasmid #116943)

• Purpose: GFPnovo2_unc-54 utr vector for expression in C. elegans
• Depositing Lab: Kota Mizumoto
• Publication: Hendi et al MicroPubl Biol. 2018 Sep 6;2018:10.17912/49YB-7K39. doi: 10.17912/49YB-7K39.

Backbone

• Vector backbone: pSM
• Backbone manufacturer: Cori Bargmann's lab
• Backbone size w/o insert (bp): 3600
• Total vector size (bp): 4469
• Vector type: Worm Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: C. elegans codon optimized GFPnovo2
• Species: Synthetic
• Insert Size (bp): 870
• Mutation: Y145F, V163A, S202T, L221V
• GenBank ID: 8382257
• Promoter: none
• Tag / Fusion Protein:
  • GFPnovo2

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: KpnI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: atgaccatgattacgccaa
• 3′ sequencing primer: ttggacttagaagtcagagg

Resource Information

• Supplemental Documents:
  • pSM.GFPnovo2.ape
• A portion of this plasmid was derived from a plasmid made by: This plasmid was generated by introducing mutations in the pSM (eGFP_unc-54 utr) plasmid which is a kind gift from Dr. Cori Bargmann.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note that some discrepancies were found between Addgene's quality control and the depositor's full plasmid sequence. The depositor noted that the backbone was not sequenced, and these discrepancies do NOT affect plasmid function.

GFPnovo2 was originally generated by Arakawa et al., (2008)

Arakawa, H., Kudo, H., Batrak, V., Caldwell, R. B., Rieger, M. A., Ellwart, J. W., & Buerstedde, J.-M. (2008). Protein evolution by hypermutation and selection in the B cell line DT40. Nucleic Acids Research, 36(1), e1. http://doi.org/10.1093/nar/gkm616