pJet1.2 specR cassette
(Plasmid
#117120)
-
PurposeSpectinomycin resistance cassette
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 117120 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepJet1.2
-
Backbone manufacturerThermo scientific
- Backbone size w/o insert (bp) 2974
- Total vector size (bp) 4010
-
Vector typeGolden gate donor vector for gene targeting in Bacillus subtilis
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSpectinomycin resistance cassette for Bacillus subtilis selection
-
SpeciesBacillus subtilis
-
Insert Size (bp)1010
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CGACTCACTATAGGGAGAGCGGC
- 3′ sequencing primer AAGAACATCGATTTTCCATGGCAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Donor vector that encodes for a Spectinomycin selection marker for Golden gate assembly reactions. Overhangs generated upon BsaI cleavage : AATA (Rup) and TCTA (Rdo).
(Gruber lab reference pSG487)
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJet1.2 specR cassette was a gift from Stephan Gruber (Addgene plasmid # 117120 ; http://n2t.net/addgene:117120 ; RRID:Addgene_117120) -
For your References section:
High-Throughput Allelic Replacement Screening in Bacillus subtilis. Diebold-Durand ML, Burmann F, Gruber S. Methods Mol Biol. 2019;2004:49-61. doi: 10.1007/978-1-4939-9520-2_5. 10.1007/978-1-4939-9520-2_5 PubMed 31147909
Map uploaded by the depositor.
