pAAV-DIO-LACTB-dAPEX2
(Plasmid
#117180)
-
PurposePlasmid name in publication: pAAV-DIO-IMS-dAPEX2. Peroxidase reporter for multiplexed electron microscopy labeling
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 117180 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAV
- Backbone size w/o insert (bp) 5614
- Total vector size (bp) 6619
-
Vector typeMammalian Expression, AAV, Cre/Lox
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLACTB-dAPEX2
-
Alt namepAAV-DIO-IMS-dAPEX2
-
SpeciesG. max (soybean)
-
Insert Size (bp)1005
-
MutationW41F and A134P on soybean APX
- Promoter EF1a
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer tcaagcctcagacagtggttc
- 3′ sequencing primer CATAGCGTAAAAGGAGCAACA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-DIO-LACTB-dAPEX2 was a gift from David Ginty (Addgene plasmid # 117180 ; http://n2t.net/addgene:117180 ; RRID:Addgene_117180) -
For your References section:
Multiplexed peroxidase-based electron microscopy labeling enables simultaneous visualization of multiple cell types. Zhang Q, Lee WA, Paul DL, Ginty DD. Nat Neurosci. 2019 Mar 18. pii: 10.1038/s41593-019-0358-7. doi: 10.1038/s41593-019-0358-7. 10.1038/s41593-019-0358-7 PubMed 30886406