Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pMRXIP 3xFLAG-VMP1
(Plasmid #117416)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 117416 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pMRXIP GFP-Ci2
  • Backbone manufacturer
    Dr.Shoji Yamaoka of Tokyo Medical and Dental University
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    VMP1
  • Species
    H. sapiens (human)
  • Tag / Fusion Protein
    • 3xFLAG (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (unknown if destroyed)
  • 3′ cloning site NotI (unknown if destroyed)
  • 5′ sequencing primer GGCATCGCAGCTTGGATACACGCC
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    It has the pMX backbone
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMRXIP 3xFLAG-VMP1 was a gift from Noboru Mizushima (Addgene plasmid # 117416 ; http://n2t.net/addgene:117416 ; RRID:Addgene_117416)
  • For your References section:

    Genome-wide CRISPR screen identifies TMEM41B as a gene required for autophagosome formation. Morita K, Hama Y, Izume T, Tamura N, Ueno T, Yamashita Y, Sakamaki Y, Mimura K, Morishita H, Shihoya W, Nureki O, Mano H, Mizushima N. J Cell Biol. 2018 Aug 9. pii: jcb.201804132. doi: 10.1083/jcb.201804132. 10.1083/jcb.201804132 PubMed 30093494