pN_35S/CTP-fluoB
(Plasmid #117991)

• Purpose: Chloroplast-targeted expression of CURT_fluoB controlled by the CaMV 35S promoter
• Depositing Lab: Mathias Pribil
• Publication: Behrendorff et al ACS Synth Biol. 2019 Mar 18. doi: 10.1021/acssynbio.8b00418.

Backbone

• Vector backbone: pN_35S
• Backbone size w/o insert (bp): 9204
• Total vector size (bp): 10407
• Modifications to backbone: pB2GW7 backbone modified to replace bialaphos (BASTA) resistance gene (bar) with a nourseothricin resistance gene
• Vector type: Plant Expression, Synthetic Biology ; Plant/bacteria binary vector
• Selectable markers: Nourseothricin/streptothricin

Growth in Bacteria

• Bacterial Resistance(s): Spectinomycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: CTP-CURT_fluoB
• Species: A. thaliana (mustard weed), Synthetic
• Insert Size (bp): 1203
• Promoter: Cauliflower mosaic virus 35S

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CTCGGATTCCATTGCCCAGCTAT
• 3′ sequencing primer: ATATGCTCAACACATGAGCGA

Resource Information

• Supplemental Documents:
  • pN_35S_CTP-CURT_fluoB.gb
• A portion of this plasmid was derived from a plasmid made by: The mCitrine coding sequence was originally obtained from the pET mCitrine LIC cloning vector (a gift from Scott Gradia (Addgene plasmid # 29771))

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry