3xHA-BioID_pAS28
(Plasmid
#118223)
-
Purposeexpresses 3xHA-tagged BioID in C. elegans intestine
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 118223 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneBluescript
- Backbone size w/o insert (bp) 6954
- Total vector size (bp) 8151
-
Modifications to backboneThe backbone contains a gut promoter and unc-54 UTR for worm intestine expression of BioID.
-
Vector typeWorm Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBioID (BirA mutant)
-
SpeciesC. elegans (nematode)
-
Insert Size (bp)1110
-
MutationR118G
- Promoter ges-1p
-
Tag
/ Fusion Protein
- 3x HA tag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site FseI (unknown if destroyed)
- 3′ cloning site XmaI (unknown if destroyed)
- 5′ sequencing primer aagaacgtgatcgcagctctac
- 3′ sequencing primer cacaatttcattgttagaggtgactt (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
3xHA-BioID_pAS28 was a gift from Jessica Feldman (Addgene plasmid # 118223 ; http://n2t.net/addgene:118223 ; RRID:Addgene_118223) -
For your References section:
Efficient proximity labeling in living cells and organisms with TurboID. Branon TC, Bosch JA, Sanchez AD, Udeshi ND, Svinkina T, Carr SA, Feldman JL, Perrimon N, Ting AY. Nat Biotechnol. 2018 Aug 20. pii: nbt.4201. doi: 10.1038/nbt.4201. 10.1038/nbt.4201 PubMed 30125270