Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pAAV-DCX(S306D)-2A-mCherry
(Plasmid #118292)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 118292 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAAV-2A-mCherry
  • Backbone size w/o insert (bp) 5429
  • Total vector size (bp) 6509
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Doublecortin
  • Alt name
    DCX
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1080
  • Mutation
    Serine 306 changed to Aspartic Acid
  • Entrez Gene
    DCX (a.k.a. DBCN, DC, LISX, SCLH, XLIS)
  • Promoter CMV with beta global intron
  • Tags / Fusion Proteins
    • 2A peptide (C terminal on insert)
    • mCherry (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site PCR insert with BglII, ligated to BamHI on the vector (destroyed during cloning)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer ggcaaagaattgggattcga
  • 3′ sequencing primer actggagtggcaacttccagg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-DCX(S306D)-2A-mCherry was a gift from Vance Lemmon (Addgene plasmid # 118292 ; http://n2t.net/addgene:118292 ; RRID:Addgene_118292)
  • For your References section:

    Dyrk kinases regulate phosphorylation of doublecortin, cytoskeletal organization, and neuronal morphology. Slepak TI, Salay LD, Lemmon VP, Bixby JL. Cytoskeleton (Hoboken). 2012 Jul;69(7):514-27. doi: 10.1002/cm.21021. Epub 2012 Mar 7. 10.1002/cm.21021 PubMed 22359282