GFP-ERK2
(Plasmid
#118296)
-
PurposeExpression of Rat ERK2
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 118296 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepeGFP-C1
-
Backbone manufacturerclontech
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameERK2
-
SpeciesR. norvegicus (rat)
-
Insert Size (bp)1077
-
Entrez GeneMapk1 (a.k.a. ERK-2, ERT1, Erk2, p42-MAPK)
-
Tag
/ Fusion Protein
- GFP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (unknown if destroyed)
- 3′ cloning site BamHI (unknown if destroyed)
- 5′ sequencing primer EGFP-C
- 3′ sequencing primer rev:acctctacaaatgtggtatg (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
ERK2 constructs were subcloned into pEGFP-C1 with XhoI and BamHI (GFP-XhoI-ERK-BamHI)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
GFP-ERK2 was a gift from Philip Stork (Addgene plasmid # 118296 ; http://n2t.net/addgene:118296 ; RRID:Addgene_118296) -
For your References section:
Examining the mechanism of Erk nuclear translocation using green fluorescent protein. Horgan AM, Stork PJ. Exp Cell Res. 2003 May 1;285(2):208-20. S0014482703000375 [pii] PubMed 12706116