Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

KAT14-pDEST10
(Plasmid #118382)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 118382 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pDEST10
  • Backbone manufacturer
    Thermo Fisher Scientific
  • Vector type
    Insect Expression
  • Selectable markers
    Gentamicin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    KAT14
  • Alt name
    CSRP2BP
  • Alt name
    ATAC2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2349
  • Entrez Gene
    KAT14 (a.k.a. ATAC2, CRP2BP, CSRP2BP, PRO1194, dJ717M23.1)
  • Promoter Polyhedrin
  • Tag / Fusion Protein
    • HIS (N terminal on backbone)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer GGATTATTCATACCGTCCCA
  • 3′ sequencing primer CAAATGTGGTATGGCTGATT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://www.biorxiv.org/content/10.1101/445973v1 for BioRxiv preprint

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    KAT14-pDEST10 was a gift from Maria Vartiainen (Addgene plasmid # 118382 ; http://n2t.net/addgene:118382 ; RRID:Addgene_118382)
  • For your References section:

    Nuclear actin interactome analysis links actin to KAT14 histone acetyl transferase and mRNA splicing. Viita T, Kyheroinen S, Prajapati B, Virtanen J, Frilander MJ, Varjosalo M, Vartiainen MK. J Cell Sci. 2019 Apr 17;132(8). pii: jcs.226852. doi: 10.1242/jcs.226852. 10.1242/jcs.226852 PubMed 30890647