HF-PX459 (V2)
(Plasmid #118632)

• Purpose: Plasmid encoding SpCas9-HF1, a single guide RNA and puromycin resistance
• Depositing Lab: Mike McGrew
• Publication: Idoko-Akoh et al Sci Rep. 2018 Oct 11;8(1):15126. doi: 10.1038/s41598-018-33244-x.

Backbone

• Vector backbone: PX459
• Backbone manufacturer: Dr. Feng Zhang Lab
• Total vector size (bp): 9175
• Vector type: Mammalian Expression, CRISPR
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: hSpCas9-HF1-2A-Puro V2.0
• Alt name: SpCas9-HF1-2a-puro V2.0
• Alt name: HF-PX459 V2.0
• Alt name: Cas9-HF1
• Species: Synthetic
• Insert Size (bp): 6179
• Mutation: Asparagine 497 to Alanine, Arginine 661 to Alanine, Glutamine 695 to Alanine, and Glutamine 926 to Alanine
• Promoter: Cbh
• Tags / Fusion Proteins:
  • 3XFLAG (N terminal on insert)
  • 2A-Puro (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: AAGCAGCGGACCTTCGACAA
• 3′ sequencing primer: CTTTCCAGCTTAGGGTACTTT

Resource Information

• Supplemental Documents:
  • Akoh-pspCAS9-2Apuro (VP12-px459)final.gbk
• A portion of this plasmid was derived from a plasmid made by: Addgene
• Articles Citing this Plasmid:
  • 6 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This is a SpCas9-HF1 plasmid generated by cloning a 1430-bp nucleotide region of SpCas9-HF1 in VP12 (Addgene plasmid #72247) encoding the four amino acid substitutions (N497A, R661A, Q695A and Q926A) into pSpCas9(BB)-2A-Puro (PX459) V2.0 (Addgene plasmid #62988).

Recipients of this material should add the following reference to their publication: “Idoko-Akoh A, Taylor L, Sang HM, McGrew MJ(2018). High fidelity CRISPR/Cas9 increases precise monoallelic and biallelic editing events in primordial germ cells. Scientific Reports 8:15126”