-
PurposeTransient transfection; Expresses RBFOX1N-dCasRx-C; CAGGS promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 118635 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepMAX
-
Backbone manufacturerAmaxa
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameRBFOX1N-dCasRx-C
-
Alt namedCasRx (NLS-dRfxCas13d-NLS) inserted into RBFOX1 (replacing residues 118-189)
-
SpeciesSynthetic
- Promoter CAGGS
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer gggcttgtcgagacagagaagat
- 3′ sequencing primer ACCGAGGAGAGGGTTAGGGAT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made bydCasRx coding sequence from Konermann et al (doi:10.1016/j.cell.2018.02.033) XR002: EF1a-dCasRx-2A-EGFP (Plasmid #109050); Effector sequence cloned using IDT gBlock as template
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
More info at http://CasFx.org . Please visit https://www.biorxiv.org/content/early/2018/09/30/431064 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAC1802_pmax-RBFOX1N-dCasRx-C was a gift from Albert Cheng (Addgene plasmid # 118635 ; http://n2t.net/addgene:118635 ; RRID:Addgene_118635) -
For your References section:
CRISPR artificial splicing factors. Du M, Jillette N, Zhu JJ, Li S, Cheng AW. Nat Commun. 2020 Jun 12;11(1):2973. doi: 10.1038/s41467-020-16806-4. 10.1038/s41467-020-16806-4 PubMed 32532987