pLV-H1-SGIPZ_NF1 sh1miR
(Plasmid #119206)

• Purpose: knockdown of NF1
• Depositing Lab: Helen Morrison
• Publication: Cui et al Hum Mutat. 2018 Nov 8. doi: 10.1002/humu.23681.

Backbone

• Vector backbone: pLV-H1-SGIPZ
• Backbone manufacturer: Modified from pGIPZ
• Backbone size w/o insert (bp): 9359
• Total vector size (bp): 9441
• Vector type: Mammalian Expression, Lentiviral, RNAi
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin and Bleocin (Zeocin), 100 & 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Growth instructions: We usually don't use Zeocin for E. coli culture.
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: sh1miR targeting NF1
• gRNA/shRNA sequence: GCTGGCAGTTTCAAACGTAA
• Species: H. sapiens (human), M. musculus (mouse), R. norvegicus (rat)
• Insert Size (bp): 82
• GenBank ID:
• Entrez Gene: NF1 (a.k.a. NFNS, VRNF, WSS)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The miRNA may also target additional species.
The vector also expresses turboGFP.
The restriction sites useful for verifying the vector and distinguishing from the empty vector (Addgene #119217) are indicated on the map; we suggest using MluI+SalI or MluI+BsrGI. Plasmid designed and cloned by Yan Cui, PhD