pLV-H1-SGIPZ_NF1 sh1miR
(Plasmid
#119206)
-
Purposeknockdown of NF1
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 119206 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLV-H1-SGIPZ
-
Backbone manufacturerModified from pGIPZ
- Backbone size w/o insert (bp) 9359
- Total vector size (bp) 9441
-
Vector typeMammalian Expression, Lentiviral, RNAi
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin and Bleocin (Zeocin), 100 & 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsWe usually don't use Zeocin for E. coli culture.
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesh1miR targeting NF1
-
gRNA/shRNA sequenceGCTGGCAGTTTCAAACGTAA
-
SpeciesH. sapiens (human), M. musculus (mouse), R. norvegicus (rat)
-
Insert Size (bp)82
-
GenBank ID
-
Entrez GeneNF1 (a.k.a. NFNS, VRNF, WSS)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The miRNA may also target additional species.
The vector also expresses turboGFP.
The restriction sites useful for verifying the vector and distinguishing from the empty vector (Addgene #119217) are indicated on the map; we suggest using MluI+SalI or MluI+BsrGI. Plasmid designed and cloned by Yan Cui, PhD
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLV-H1-SGIPZ_NF1 sh1miR was a gift from Helen Morrison (Addgene plasmid # 119206 ; http://n2t.net/addgene:119206 ; RRID:Addgene_119206) -
For your References section:
Construction of cloning-friendly minigenes for mammalian expression of full-length human NF1 isoforms. Cui Y, Morrison H. Hum Mutat. 2018 Nov 8. doi: 10.1002/humu.23681. 10.1002/humu.23681 PubMed 30408279