Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pGL4.23-MYC-e4
(Plasmid #120342)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 120342 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pGL4.23-MYC
  • Backbone size w/o insert (bp) 5322
  • Total vector size (bp) 7438
  • Modifications to backbone
    pGL4.23-MYC is a modified version of the Promega pGL4.23 vector. Contains the MYC promoter in place of the minimal promoter and polyadenylation signals flanking the enhancer cloning site.
  • Vector type
    Mammalian Expression, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    chr8:129060477-129062593 (hg19)
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2116
  • Promoter MYC

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CACTGCGGCTCCTCATCGCG
  • 3′ sequencing primer TCCGGTGCCCTGAATGAACT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGL4.23-MYC-e4 was a gift from Eric Lander (Addgene plasmid # 120342 ; http://n2t.net/addgene:120342 ; RRID:Addgene_120342)
  • For your References section:

    Systematic mapping of functional enhancer-promoter connections with CRISPR interference. Fulco CP, Munschauer M, Anyoha R, Munson G, Grossman SR, Perez EM, Kane M, Cleary B, Lander ES, Engreitz JM. Science. 2016 Sep 29. pii: aag2445. 10.1126/science.aag2445 PubMed 27708057