FLAG-PPP2R5E siRNA-resistant
(Plasmid #120861)

• Purpose: expresses dox-inducible PPP2R5E resistant to siRNA pool 2 used in manuscript
• Depositing Lab: Emily Foley
• Publication: Lee et al J Cell Sci. 2017 May 15;130(10):1760-1771. doi: 10.1242/jcs.201608. Epub 2017 Apr 12.

Backbone

• Vector backbone: pcDNA5/FRT/TO
• Backbone manufacturer: ThermoFIsher
• Backbone size w/o insert (bp): 2300
• Total vector size (bp): 6700
• Modifications to backbone: none
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: PPP2R5E
• Alt name: B56 epsilon
• Alt name: B' epsilon
• Species: H. sapiens (human)
• Insert Size (bp): 1437
• Mutation: silent mutation at aa 282-284 in PPP2RE to generate siRNA-resistant RNA
• Entrez Gene: PPP2R5E (a.k.a. B56E, B56epsilon)
• Tag / Fusion Protein:
  • FLAG (N terminal on backbone)

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: AGCTCGTTTAGTGAACCGTCAGATC
• 3′ sequencing primer: GAAAGTATTGATCCCTTTACAC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: openbiosystems

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry