Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

AAVS1-Puro-CAG-GCaMP6s
(Plasmid #120896)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 120896 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    AAVS1-CAG-hrGFP
  • Backbone manufacturer
    Su-Chun Zhang
  • Backbone size w/o insert (bp) 8085
  • Total vector size (bp) 11644
  • Modifications to backbone
    replace hrGFP with GCaMP6s
  • Vector type
    Mammalian Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GCaMP6s
  • Species
    Synthetic
  • Insert Size (bp)
    1353
  • Promoter CAG

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (not destroyed)
  • 3′ cloning site MluI (not destroyed)
  • 5′ sequencing primer pCAGGS-5 (GGTTCGGCTTCTGGCGTGTGACC)
  • 3′ sequencing primer Bglob-pA-R (TTTTGGCAGAGGGAAAAAGA)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAVS1-Puro-CAG-GCaMP6s was a gift from Xiaojun Lian (Addgene plasmid # 120896 ; http://n2t.net/addgene:120896 ; RRID:Addgene_120896)
  • For your References section:

    An Ultrasensitive Calcium Reporter System via CRISPR-Cas9-Mediated Genome Editing in Human Pluripotent Stem Cells. Jiang Y, Zhou Y, Bao X, Chen C, Randolph LN, Du J, Lian XL. iScience. 2018 Oct 12;9:27-35. doi: 10.1016/j.isci.2018.10.007. 10.1016/j.isci.2018.10.007 PubMed 30368079