-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 12145 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCMV5
- Backbone size w/o insert (bp) 4657
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameFoxo1
-
Alt nameFkrh
-
Alt nameforkhead box O1
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)2100
-
MutationContains a deletion truncating the protein after amino acid 255. Acts as dominant negative, lacking the transactivation domain
-
GenBank IDNM_019739
-
Entrez GeneFoxo1 (a.k.a. Afxh, FKHR, Fkhr1, Foxo1a)
- Promoter CMV
-
Tag
/ Fusion Protein
- Myc (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer CMV-F; pCEP-F
- 3′ sequencing primer hGH-pA-R (CCAGCTTGGTTCCCAATAGA) (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Plasmid also contains a G229R mutation--author says that it will not affect the plasmid detrimentally. It also has polymorphisms K219R and L619R (the latter is not translated - it's after the truncation).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Myc-Foxo1 D256 was a gift from Domenico Accili (Addgene plasmid # 12145 ; http://n2t.net/addgene:12145 ; RRID:Addgene_12145) -
For your References section:
Differential regulation of gene expression by insulin and IGF-1 receptors correlates with phosphorylation of a single amino acid residue in the forkhead transcription factor FKHR. Nakae J, Barr V, Accili D. EMBO J. 2000 Mar 1. 19(5):989-96. 10.1093/emboj/19.5.989 PubMed 10698940