pAAV-DIO-trkB.DN-mCherry
(Plasmid #121502)

• Purpose: Expresses trkB.T1 fused with mCherry in a cre dependent manner.
• Depositing Lab: Marie Carlén
• Publication: Guyon et al J Neurosci. 2021 Feb 15. pii: JNEUROSCI.1848-20.2021. doi: 10.1523/JNEUROSCI.1848-20.2021.

Backbone

• Vector backbone: pAAV
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 5591
• Total vector size (bp): 7667
• Vector type: Mammalian Expression, AAV, Cre/Lox

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Growth instructions: Please use Rec A- competent cells such as Stbl3 cells from Invitrogen for transformation.
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: trkB.T1
• Alt name: truncated version of tyrosine receptor kinase B
• Alt name: NTrk2 variant 2
• Species: R. norvegicus (rat)
• Insert Size (bp): 2076
• Entrez Gene: Ntrk2 (a.k.a. RATTRKB1, TRKB1, Tkrb, trk-B, trkB)
• Promoter: EF1a
• Tag / Fusion Protein:
  • mCherry (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AscI (not destroyed)
• 3′ cloning site: NheI (not destroyed)
• 5′ sequencing primer: ggccagcttggcacttgatg
• 3′ sequencing primer: GCAATAGCATGATACAAAGG

Resource Information

• Supplemental Documents:
  • pAAV-DIO-trkB.T1-mCherry.gb
• A portion of this plasmid was derived from a plasmid made by: trkB.T1 is cloned from prattrkBT1 from Lino Tessarollo's group at National Cancer Insitute, NIH

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry