1
Plasmid 12198: LL - hOCT4i -1
  • OCT4 - RNAi

  • Oct4

  • 55

  • H. sapiens (human)

  • POU5F1 (DADB-104B20.2, OCT3, OCT4, OTF-3, OTF3, OTF4, Oct-3, Oct-4)

  • pLL3.7
    (Search Vector Database)

  • Mammalian Expression, Lentiviral, RNAi, Cre/Lox

  • 7650

  • HpaI

  • Yes

  • XhoI

  • No

  • n/a List of Sequencing Primers

  • Ampicillin

  • DH5alpha

  • 37

  • High Copy

  • View sequences (2)
  • George Daley

  • MTA

Comments: 

Target sequence: CATGTGTAAGCTGCGGCCCTT
(NM_002701: bp 642-662)

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: High-efficiency RNA interference in human embryonic stem cells. Zaehres et al (Stem Cells. 2005 Mar . 23(3):299-305. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 12198" in your Materials and Methods section.

Price: $65.00

Available to academic and non-profits only