pCoofy61
(Plasmid
#122013)
-
Purpose(Empty Backbone) E.coli vector for parallel SLIC cloning containing N-terminal His6-eGFP with PreScission Cleavage site
-
Depositing Labs
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 122013 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepETM-NG
-
Backbone manufacturerNovagen
- Backbone size (bp) 6472
-
Vector typeBacterial Expression
-
Tag
/ Fusion Protein
- His6-eGFP (N terminal on insert)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DB3.1
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameNone
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
ccdB Survival cells are NOT suitable for the unmodified plasmid containing the ccdB gene. The plasmid is provided in the recommended DB3.1 strain. Please see supplemental file for LP1 and LP2 primers to use for SLIC cloning. A detailed protocol for using pCoofy plasmids is available at https://p4eu.org/wiki .
Use one of the following linearization primer pairs for SLIC cloning. Choose one LP1 forward vector primer and one LP2 reverse vector primer:
LP1 forward vector primer: SLIC Primer (3C site) 5' GGGCCCCTGGAACAGAACTTCCAG 3'
LP2 reverse vector primer: SLIC Primer 5' CGCCATTAACCTGATGTTCTGGGG 3'
Test each preparation of the plasmid by transforming it into non-resistant cells (ex. DH5a) to ensure negative selection by ccdB kills all the transformed cells as expected.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCoofy61 was a gift from Peggy Stolt-Bergner & Sabine Suppmann (Addgene plasmid # 122013 ; http://n2t.net/addgene:122013 ; RRID:Addgene_122013) -
For your References section:
A new method to customize protein expression vectors for fast, efficient and background free parallel cloning. Scholz J, Besir H, Strasser C, Suppmann S. BMC Biotechnol. 2013 Feb 14;13(1):12. 10.1186/1472-6750-13-12 PubMed 23410102