Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

PB-TRE-dCas9-KRAB-MeCP2
(Plasmid #122267)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 122267 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    PB-TRE
  • Vector type
    Mammalian Expression
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    dCas9-KRAB-MeCP2
  • Species
    Synthetic
  • Insert Size (bp)
    5346
  • Tag / Fusion Protein
    • dCas9-KRAB-MeCP2 (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GCCCAAATTCTCGATTCACGC
  • 3′ sequencing primer CTCGGTGGGGTATCGACAGA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PB-TRE-dCas9-KRAB-MeCP2 was a gift from Andrea Califano (Addgene plasmid # 122267 ; http://n2t.net/addgene:122267 ; RRID:Addgene_122267)
  • For your References section:

    Interrogation of genome-wide, experimentally dissected gene regulatory networks reveals mechanisms underlying dynamic cellular state control. Tan X, Worley J, Turunen M, Wong K, Fernández EC, Paull E, Jones S, Wang J, Noh H, Salvatori B, Chavez A, Califano A. bioRxiv 2021.06.28.449297 10.1101/2021.06.28.449297